>JMCP009H05 581 bp,:Filtered
ATTCTGCACCTTTGTCTGGATCACCCAAGTCATTgTAGTAGGCATAGTCATACACCCTGT
CCCATTCCTTAAGCTCGCCAGTTCCTGTTCCTCTCAAGTGCACTAATTCTTCATCTCGAT
ATTTCTTCAACGGGGCAGGTGTTTGGCTTGGAAGATATGCCTACAAGAATTAAATAATTA
ATACAGGAAGTCAAATAAGATCAACCCTAATCAAACTGAATGAAATCATTAAACACACAC
TTCAACACAAATTTGAATACGGAGTATATGATAATCAAAGAGAAAACTAGAAAAAAGTAC
AGATATATATTGGCATCCAAATTGAACAATTCGAACAACGAATCACATATGCATGCTCCT
CAGATATCAATTAATTTTGAAGGTTCTATAAATGCTCGGTAGTTTCTATTTATTAAAATA
AATGGAAAATTTTAAGGCTAATCACAAAGGCATACCATTCAAAATTTGACCTAATATGAA
GAAAATCAACATCCAATCCGATGAACATTACGATTTACGGCAACTCCAAAAAC