>JMCP009G11 656 bp,
AGTGAAAGCTAAGGTGGAGATCGAGTATTACTAGCTAGAATCGCCGCTTTCACGCTAGTT
TTGTGAGTACACTCCTACACTATACTACAAGGCCAAGATCACACTTTTCCGTTTATTGTA
ATAGGCCAATAGTCCACGTTGCAAGAGATCTCcaAACCAGGAATACACTTGTCTATACAT
TCATGCAAGATACGGGTATATTCTGCCTATACATATACATATACATATCAACTGATATAC
GCAATGGAATTTGTATTGTTATATACCAAAAACATATACTTTCATGACAGTTCTTCACAT
GGCCTGCATTTACTGAACGAAAAAGAAGGAAAAAAGGCAAACAAATTGTCTTTGGACAAA
ATATACTAACTAACACTCTTTTCTAGCCTTTGAACACATTTCATTATGTTTTTCCATTTT
CCAAATCGAACAAGTGTTAGTTTTTACAATAATACCCCTAAAACCCAATAATTAGTGCAT
ACCCGGCGAGGCTAGCTCAAGTGGTAAACCATCTAGCATAAAGTCACCTCTTTAGTAACA
AGGTAGGGTTTAACTTCCACCGCCAACGACATCTTGGAACTAAGGCTTCCCAACCTAGAT
TTTGGGCCATTG