>rJMCP009E10 250 bp,:Filtered
AGGAGATAAACAACTCAAACCCTAAATTCAATTTATGGATTTATATGCAACAGAAGAGCT
GCAATCTTGTAAATCCATTGACAATTCACAAAACATCAGCTGAAATCATGGAGAAAACGG
AGAAGATGAGTGAAATGTGAAGATTAAAACAAAAATTCTTTAAAAACAATCTAATTTCAG
AGAAGAAACTGGAAAACAACAAATC