>JMCP009E07 659 bp,
CTCTCAGCTCCGGATTTCAGTTTGATCGCCGAACTGAGAATTCCACCGCCGGCGGCCCAA
AATGGTGCACGTCAACTTTTACCGGAACTATGGGAAGACATTTAAGAAGCCTCGTAGGCC
ATATGAGAAAGAGCGATTGGATGCTGAGTTGAAGCTTGTTGGTGAGTATGGACTTAGGTG
CAAGAGGGAACTCTGGAGGGTTCAGTATGCATTGAGCCGTATCAGGAATAACGCAAGAAT
GCTTCTCACACTCGATGAGAAGGACCCAAGGCGTATTTTTGAGGGTGATGCCCTTTTGAG
AAGGATGAACAGGTATGGCTTGCTTGATGAGAGTCAGAACAAGCTTGATTATGTCCTTGC
CCTAACTGTGGAGAACTTCCTTGAGCGCCGTCTCCAAACTCTTGTGTTCAAGGCTGGCAT
GGCAAAGTCAATCCATCATGCTAGGGTGCTCATTAGGCAAAAGCACATCAGGGTTGGAAG
GCAGGTTGTGAACGTCCCCTCCTTCTTGGTCAGAGTGGACTCGCAGAAGCACATTGATTT
CTCACTGTCCAGTCCTTTTGGTGGCGGTCGCCCTGGTAGGGTGAAGCGAAAGAACCAGAA
GGCAGCTGCCAAGAAGGCTGCTGGC