>JMCP009D04 332 bp,:Filtered
aagGAAAGTGCGAGGAAGGGTATGATTTGAACTCTACCaatTGTAACaggTAATAAGCGA
GAAGACAAGCTAGTTTCATGTCCAAGGTTCAGTGTATTTGAGTAGCTTAgcTAGCAACTT
ATAtaAATCTTTGTTGGGACTCTTATTaggAAATTAATTGGGGCTAGATTTTACTAcgaT
GCCTTGGAGTGCCATTTTTGTCAACAAGGGACACGTTAGGCCATGGAAGTCATGTTGTGT
CAACgacggctaTTTCAGTAATTAAAATCGTGTCATACTATCGTTTC