>JMCP009D03 657 bp,
CGGCGGACAAGGGCTGAGCATCCGCCGTGGGGCCACCGGCGGCAGTAGGCGGAGTTGGCG
TGGGAATTTCCACAGGCTTTCTTGAACGGTTGCGGCCACGGTGCATGTGGCGCTCACAAT
ACTTCTGACCCGCCACCACGTCCCTCGAGCACCTCCACTTCTTCCCGTCGGTCCTCCGGC
ACCGACCCGGCTCCGGATCCATCGCCGCTCTCCCCCAGTACCAAGGTGCTGAAGCAGGGT
GATAATGGGGATATTGGTGAAGAGGGTGAGGGAAATAGTAAGGAGCAGAGTTGAAGGGGC
TCTTTTTAACCAGGTGGAGAAGCTCAGGTGGAACAGGTGCCCCAGCAATCATGTGTCTGA
AGATCAAAGCCTGCAGTTCAAGCTCCTGCCACTGCCCCAAGCTGAAGTAACTTCCACCCA
TCCTGGGAAATTTGGTGGTGGCAGTGGGTGTGGAATCAGAAGAGAATGCTGACAGCTTGC
TGGTGGGGGGTTCAGAGACAAACAATGGAAGTGCAGAGGAAGATGACCCCCCACCCCCAC
CCCCATGACTAGCTGTGGTAGTGGTGGAGTGGAGATCAAGCACAAGTCTTGGTACCTTTG
CTTCTGAC