>JMCP009C05 645 bp,:PolyA
AATTCCGGCAGctgTTAAATCTGCTGGACTTGAACTGGATGATACCGATCTTTTTGAGAT
CAATGAAGCATTTGCATCACAGTATTTATACTGCCAAAAGAAGCTGGGACTTGATCCAGA
GAAGATCAATGTAAATGGAGGTGCCATGGCTATTGGTCATCCTTTGGGTGCAACAGGAGC
TCGGTGTGTTGCAACTTTGTTGCATGAGATGAAGCGTCGTGGCAAAGACTGCCGCTATGG
TGTGGTTTCCATGTGCATAGGCACGGGAATGGGTGCTGCGGGTGTTTTTGAGAGAGGCGA
TGCTTGTGATGAGCTCAGCAATGCCCGAAAAGTCGAAACTCATGGCTACTTGTCTAAGGA
TGCTCGGTAGACCTCTCATGGTGTATAAATCTCTTGGTTTCATCAATAATTTATGAAGTG
GGAAGCAGTGACATCAATAAGTTAAATTTTTAAGGGTAGTAGGGAAGTTTTTACTGTGGC
ACTTCAATTGTATGATTGGATTACAAATTCCCAGACTTTAATTAATATCAAGTAATTGTA
GCAGCATAATAATCAATGAGAACTTGTGTAATCCTGAGTGTTGAAATATATTTATAATTA
GTTTATTACAAGG