>JMCP009B10 433 bp,:Filtered
TCATGCAGACTTACATCGGGGGAGTTTCGTGCCCATACATATGCTCCAAGAGGCTGGACC
ATGGTGTCCTGTTGGTGGGTTATGGTTCAGCAGGCTACGCTCCCATCCGGTTGAGAGAAA
AACCATATTGGATCATCAAGAACTCGTGGGGCGAGAGCTGGGGAGAGAAGGGATACTACA
AGATCTGCCGGGGTCGCAATATCTGTGGAGTGGACTCCATGGTTTCTACTGTTGCAGCTG
TTAACACCCCCACTTCAGACTAGCAGGACAGGACACGTTCTGTAAAGTAGTTCTGTAAGA
TATTGTTTGTTTGCAAGCGTCTCACAGAGAGCCACACAAAACAACATACTATGCAAGTGT
ATTCATTATTAGATTTCATCAATCTATTTCTCAATTTCGTTAGG