>JMCP009B09 613 bp,:Filtered
TTCAACACTGACAACAACAACAACTACTACTACACCAACAACCGAGAAGAAACCTTCCCC
ACCACCACCACCGGCGGCGGCGGCGGCAACCGCTACAACTACAACAACGGCGGCGCTGCA
AACAGGTTTGAGCAGCAAGGGATGAGCGACACAAGATTCATGGAaaaTGGGAGGTATTAC
TATGATGTCAACACAGAGAAGTACGCCAGACATCCATACGAGAATTCAAGAAACCAGTTC
AACAACGATGGGGGATTCGACAACAACAACAACAACAACAATGGGTTCATGGAGAACAAC
TACCAGGATATGGAGGAGTTCCAGGACCAAGAAGACCTTCCCTGAGATTCCTTAACAATT
TTTTTTTTTCTACAAAGTTAAAagaTGATCATGTGACGGagtCCCAAAATCTGCAAATTA
AACACAcGACTGGGTGTTTGATTGTGTGTTAAATTATGGTTGTTTAGGGGTGAATATGTT
GATGATGATTAAGCTATagaTTTGTTCATAGGTTATTAATTATCTCCTGTCTCTATAGTT
ATATTgtgTGTGAAtgagaccATGAAACTATGGTTTTGTGT