>JMCP009B08 656 bp,
GTTCGTTGCAGTGGACCTGAGGGTAGACATTCTGGGGAAAAAAAGTTGCCAGGGAAATGG
CTCTCCTAGATCGAAGAGCTGCTATAGTCCACAGGAGATAGCTCAATTCTTGAGAAAACT
TGGTTTTAACAGCGGGACTACTATATATTTGACTCAAACCCGGTGGGATAGCAGCCTCGA
TTCACTGAAGGAGCTCTTTCCAAAAACTTACACCAAGGAAAGTATAATGCCTATTGATAA
GAAGGCAAAGTTTCTTGACGCTGATGCATCTGAGTTGGAGAAGGTTATTGACTTCTACAT
TTGCTCGGAGAGTGATGTATTCGTTCCGGCCATCTCAGGCTTATTCTATGCAAATGTAGC
TGGTAAGAGAATTGCTTCTGGGAAGACTCAGATTCTTGTTCCAGCTGACATCACTGCTTC
ATCGGCTTCTTTAACCGATCACATTTCCCACTATGTCTCCAAAAAGAACCACTTCGCGTA
TTCATGTTTCTGCTAGGGTTGATGGAAAACTGAAAACCTGTCCGGAAAAAGCCCTATGAT
TGATTCTCATACTACTTTTGTTTAAGCACTTCTAAGTACAAGACAATGTAGAATTTCCCA
CTACTGCGATCTTTTCCTTTTT