>rJMCP009B02 541 bp,:Filtered
TTCAACACTGACAACAACAACAACTACTACTACACCAACAACCGAGAAGGAACCTTCCCC
ACCACCACCACCGGCGGCGGCGGCGGCAACCGCTACAACTACAACAACGGCGGCGCTGCA
AACAGGTTTGAGCAGCAAGGGATGAGCGACACAAGATTCATGGAAAATGGGAGGTATTAC
TATGATGTCAACACAGAGAAGTACGCCAGACATCCATACGAGAATTCAAGAAACCAGTTC
AACAACAGTGGAGGATTCGACAACAACAACAACAACAACAATGGATTCATGGAGAACAAC
TACCAGAATACGGAGGAGTTCCAGGACAAAGAAGACCTTCCCTGAGATTCCTTAACAACT
TTTTTTTTTTTCTACAAAGtTAaaaaatgaTCatgtgaCggagtccCAAAATCTGCAAAT
TAAACACAcgactgGgtgTTtgaTTgtgtgttAAATTATGGTTGTTTAGGGGtgaataTG
TTGatgatgattaagcTatagattTGTTC