>JMCP008H12 645 bp,
CTCTCAGCTCCGGATTTCAGTTTGATCGCCGAACTGAGAATTCCACCGCCGGCGGCCCAA
AATGGTGCACGTCAACTTTTACCGGAACTATGGGAAGACATTTAAgaAGCCTCGTAGGCC
ATATGAGAAAGAGCGATTGGATGCTGAGTTGAAGCTTGTTGGTGAGTATGGACTTAGGTG
CAAGAGGGAACTCTGGAGGGTTCAGTATGCATTGAGCCGTATCAGGAATAACGCAAGAAT
GCTTCTCACACTCGATGAGAAGGACCCAAGGCGTATTTTTGAGGGTGATGCCCTTTTGAG
AAGGATGAACAGGTATGGCTTGCTTGATGAGAGTCAGAACAAGCTTGATTATGTCCTTGC
CCTAACTGTGGAGAACTTCCTTGAGCGCCGTCTCCAAACTCTTGTGTTCAAGGCTGGCAT
GGCAAAGTCAATCCATCATGCTAGGGTGCTCATTAGGCAAAAGCACATCAGGGTTGGAAG
GCAGGTTGTGAACGTCCCCTCCTTCTTGGTCAGAGTGGACTCGCAGAAGCACATTGATTT
CTCACTGTCCAGTCCTTTTGGTGGCGGTCGCCCTGGTAGGGTGAAGCGAAAGAACCAGAA
GGCAGCTGCCAAGAAGGCT