>JMCP008H10 475 bp,:Filtered
ATGCTAAATGGGAGAGACCCCCTCTGGGTTGGCTTAAGCTTAATGTTGATGCAGCCTTGG
ATTATGGTAACAGAAGAATGGGGCTGGGCTTTGTTTTGAGAGATGCTGAAGGAACATTTG
TGGCTGCAAAGGAAATTCCCATATCTGGCTTATTTAAACCCAAGGAAGATGAAGCTATAG
GAGTAAGGGAGGCTTTAAAGTGGATTAAGGATCTCCAATATGACTTCATACAGCTGCAGC
TCTACTCCTCTTTTGATCTCATCATTAATGATGTTAAGGAATTAGCTAAAGACTTTTTGA
ATATTAACTTTTTGTTTGCTAAGCGGTCCGCGAACAAGGTTGCCCACTTACTAACTAGGG
AGACCTTGTTTAAGTCTGATTGTTCGGTCTATTTTTTTATTCCGTTTCCATCTATTGTTT
AATATATTAGTTCTTCATTTCTCTG