>JMCP008H03 217 bp,:Filtered
CTTTTGCCGCGTAATACGTAAGCCTCCAAAAGATCATTCTTCTCCCAGAGAAATAGTGGT
AGACGACTTGAGCTCTAGAGAGAGAGAGAGAGAGAGAGAGAGAGAATtctGCTGAAGAGG
ACTTCTCCTCCTTCAGTACAGTTTTTTTGTTTTGcttgcAGAATCGATCGTTCCAACaaT
CGCGATGAGTTTCCTCTTCGAC