>JMCP008G04 576 bp,
AGGTCTAGAAACATCATATCTAATAAAAAACATGGTAGTAGATGGATCATGGAGTAGCCA
AGGCCACCATTCCATTTTAATTTGAAAGAAACAATCTTTTTGGTAGAACAGTACAGTTGT
ACCTTCTGATTGTTAAAATTGGTCATAATTATCATAGGCCAATTAAGTCAAGACTCAAGC
GGAGCAATAATGTTTAATTTGTTGATATCATGAACATTAGCATTGTGTGAATTGATCAAC
TTCTATATATGATCTATCTCATCTAAATAATCATGTTAAGATGATCTGAACATCTAACCA
GTAGTACTATCAGATAGATGCATTAAAACTTCAAAACTTAAATTTAATTTGTATCATTAA
AAGAGTCCCTAAAATTACCTCCTCCGTTCCAAATATTAGCTTCGCTGCTTGACAGTGAAT
GGGTGAGTGTAAATGAagaATAAAATgttTTCCTTTTCTTATCttAAGATAatagagaGa
gataatTCatgcatgcctCGaggtaACTttaggagtggAAAataAcATTTTAACAATTAT
GAAAAA