>rJMCP008F04 344 bp,:Filtered
AAGATTGGAGATGGTAAAACTGAAATTCATATATTGATTATGACGAGTCTAAAATGGAGC
TGTTATTGTGGGGGTCTGATTCTCCAACCAAGTTTTCTGTGTACTCTGCCATTCCCATGC
TGCTTTTCCTCCCAGCATATATGCTGTTGTGCTGTATTACTAATATGATGATTTATTAGG
GTATAGTAGAGGGCGGTGCATAGCTGTCTGGGTACTTGCCCCTAACCTTACGAACTGGAA
ATACGCAGGATTTGTGCTTGGATTTGTCTTTCTTTAAATAAAGCTTGTGTAATATCTACC
AC