>JMCP008E12 273 bp,:Filtered
AACGCAGAGTTCATGACTCCGTCCCGTCCTGGATAGACCAAATGTACATAGATCAGGAGC
AGGTGGTTGCTTAAGGGAATCTCTGTGGCCATGCATTTTCTCCATGGCTAATCAAATAGT
AATATTCTTTCATATTCTTACTAATATGTTCTAAGATGTATGTAGCCAGTCAGTAGGTTC
AAAGTTTACACCAACACACCCCCCTGTTGGATGGGAACAGAAATGGATAGGAAGAACAGA
CTGATCTTTAGATTTATTTGAGAAAAAACAGAC