>JMCP008E04 496 bp,
AACGCAGAGTGTCCATCACCGCCAATCCGTCCTCCGTCGCCACCCGCCGCCGAACCGCCG
TCGAGAAAAGGCAGCCCGCCGCTTTGGACATTGCCGAATCCAACTTAGCGGCCGCGGCCG
CTGCAGCCGCCGTCGCGTCTCCATCCACAGGCAACGATAAACACGCCGCAGGCGACGCTG
CTATCAAAGATCTAAGTCAACATTCCATTAGAACGGAAACTAGAGATGCAATTCAAGCGG
TCAGGAAGCCCTTGCCCAACTCAAACGGCGCCGCGCCTTCGTCTCGCCGTGCGGGGACCA
CGAAGAAATCTTCCAAGCCCGAGAAACCGCGCTGGCTCACGGTTGTTAGTATATTCACTA
AGAATTTCTGTCTTTTGTTAATCATAGTAGGTTTAATTCAGATGGTTCGGAGAATTTTTT
TCGATTCGGGAAGTCGAAATGCCGACGGACTCACCGTGATCTCTGACGATTTCGaGGGCA
AAGTTGCGGaaCTGGA