>rJMCP008D07 644 bp,
TTCAACACTGACAACAACAACAACTACTACTACACCAACAACCGAGAAGAAACCTTCCCC
ACCACCACCACCGGCGGCGGCGGCAACCGCTACAACTACAACAACGGCGGCGCTGCAAAC
AGGTTTGAGCAGCAAGGGATGAGCGACACAAGATTCATGGAAAATGGGAGGTATTACTAT
GATGTCAACACAGAGAAGTACGCCAGACATCCATACGAGAATTCAAGAAACCAGTTCAAC
AACAATGGAGGATTCGACAACAACAACAACAACAACAATGGATTCATGGAGAACAACTAC
CAGAATATGGAGGAGTTCCAGGACCAAGAAGACCTTCCCTGAGATTCCTTAACAATTTTT
TTTTTTTCTACAAAGTTAAAagaTGATCatgTGACGGagtCCCAAAATCTGCAAATTAAA
CACAcgactgGGTGTTTGATTgtgTGTTAAATTATGGTTGTTTAGGGGTGAATATGTTGA
TGaTGATTAAGCTATagaTTTGTTCATAGGTTATTAATTATCTCCTGTCTCTATAGTTAT
ATTgtgtgTGAAtgagaccATGAAACTATGGTTTTGTGTCAACTGGTctagacCAAATCT
ATATATTAAACT