>JMCP008D04 156 bp,:Filtered
CGCGCTTAAGCGCCATCCATTTTCGGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACAC
TCCTTAGCGGATTTCGACTTCCATGACCACCGTCCTGCTGTCCGTTAAAGGATGATTGTG
CGCTCGCTACGAATCTGCCCAAGCGTAAAAGAAAAC