>JMCP008D01 381 bp,
AAGCAAGAGAGCATCAGCTGATAATGGAGGAGAAAGGCAAAGGGAGTGAGAGATGGACGG
CTGCGATCGCGAATTTCTCAGAGATGGCAGGCAATCTTGACTCCCTGCAAAAACTGCTTA
TCAAGAAAGCGGTCTATGTCGACGAAGACACATACTCAAAAGCCTATCTCATCTCCGAAC
AAGCCCGAACCATCAAGGTTCTTGAGCAGAGAGTTGAGACTTTAGAACGGGAACTAGATT
CTGCCATTTCAGCTGCTGCTCGTGCACGGACAGAGAAACGACAAGCAGAGGCAGCTCAga
aggcTGCAGaaCTACAGGCACAAGAGATCACAAAAGAGCTTG