>JMCP008C08 389 bp,:Filtered
GGAACTACTTTGATTGATATAGAGTCCACTTGGGCGGAGTTGGCTAGCTATGTTGATATC
TCTGTTCGTCCGCCGTGGATTCTAGATGATGTTGTGACCAGACTCCGGTTTCTGTGTTCC
TGTGGGGTGGTTACTGCTTCTGTGTGCCCGTCCAGGGCCAATATGCCTGCACAGGCGCTA
GCTAACTGGGCGGTGGATAAGCCGGGGGAGGCCATCTTTCGGAGCCTCAATGATCTGCCA
CGTAGGGTCCGTGCTTTACTGATACATGATGATGTGCCCTATGTGTTTTTTGATATTGAT
GATCCCCCGTGATTGTACTTGTACTTTGTTTGATTAGTTGGAAATTTGGAAATAAGAAAA
AAC