>JMCP008B10 502 bp,:Filtered
TTTGATTTAAAGCGAAAGCGCAAAGCAAAGCGTCACTTTTTCAAACAAAACGAAGCAAGT
CACTTTTTTACACAAAGTGATGCTTTTCCAAAGAATAACAATTAATTCAACACTGAATAT
TTAACAATCAATTCAATAATCATTATTCAAATTTCAACAATCAATATTCAAAGATTCAAT
ATTGTATATTCAATATTTGTATCACAAAAACCGAACAAAAAAATTGCAAAATCAAAAAAC
ATTAAAATTACAATTTTCAGCCTTAAGCCTTTTAAAAGTTTTAAAGAAAAAATTAAGGGA
GTATAACCTGATTAAAAAGTAAATTTAAAATTACAGCTTTATGCCTTTATAAATGTGTTT
TTTAAAAAGTAAACCTTTAATATATTTTTTAAAGAATAAAAGAATCTGAATATAAGATCT
TCAGAAATAGAGAAAAGTGGAAGACTACCTTACGGTCCTTACTGAAAACTTCGAG