>rJMCP008B07 654 bp,
TTCATCGTCGGCCTGGAAGATAATCCGAAAGCATAACAAGTTTCGCTGCGTCAATTCGGA
GGTGCGGTCATGGCTGAAGAGGAAATCCAGAACGAGATGAAGGAGGAGGTTGCAGATATT
GCTCCATTTGATCCTACAAAAAAGAAAAAGAAGAAGAAGGTTGTTATCCAGGATCCTGCA
GCagaTGATTCTGTCGATAGCTTGGCTGagaAAACTGAAAGTTTGACAGTTTCAGATGGT
CTTGAGACAGCATTTTCTGGCAAAAAGAAGAAGAAGAAGCCTGTACACACTGATCTCTTG
AATGATGAGATGGATAATACAGGGGACGATATAGATGATCACTTCGGAGATGATGAAGAA
GCTGAAGAAATTGTTCTCCATCGCTATCCATGGGAAGGAAGTGACAGGGATTATGAATAT
GAGGAGCTTCTAGGTCGTGTTTTCAATATCCTTCGTGAAAATAATCCCGAGCTTGCTGGA
GACAGGCGTAGAACAGTAATGAGGCCTCCTCAAGTCCTTCGTGAAGGTACAAAGAAGACT
GTCTTTGTTAATTTCATGGACCTTTGCAAGACGATGCATAGGCAGCCAGAGCATGTCATG
ACTTTCTTGCTGGCTGAAATGGGAA