>JMCP008B04 541 bp,
TGAAAAGGGGCAAAAAGTTCTAACAGCAAGCAGCCCATAGTTACAACCACCTTGTTTTTC
GCAAATGTAATAAATTATGGCTTTCCATTGTAAGCTATTGAATATGCTAAATGAGAGCCA
ATTTAGGGAGAAGAAGATAAATTCCCAAGTACAAACTAACACAGTATCTTGTACACTCTA
AGCATAGATGGCCTAGTTGTCATTCATGGAAATCTAGGAACTCAAACTAATACTCCGTAT
TAAGATAACGTGACAATCTTTTTCCTAAATCAGATTAAGTAGTAAAGATACATGACGCAG
TATACTTCATTGAGCTTCAGTGTACAAAATAACATCAGATAAACTAAAGTTTCTTAAATA
TATTCATAACAGTGGAAGGCTTTAGTCAAAACCGAGATCATATAACGAAATTAATGACAT
GTTCACTACAAGATTCATATGCATGCAAATGCACCTTTTTCACCTTTTCTTCaaAGCAgt
tAACTAAAAattgttaaTTTTGTTTTACA