>JMCP008B01 376 bp,
GACTGAATGCAATGGCAGTAACACCTCCTGTGTGTCCACGCAAAACTGAAATAGGCAACC
CATCTGGCAAGCGCCACTGGAATATAGAAGATTACATAATTTACTATTAAAATAAAGAGA
GCTGAACCATTATATTTCTTTTAAAGATTAATACGCAACCTGTGGTGTTGAATTAGGCAG
ATCCCTACTTTCTATAATAAAGCATGGAACTAAATCTGATTTTAATCCTCAAACTATGGT
GGTATTCCCTCTCGGTACCCTACTATCAATTTTTACAAATAATCCCCCACCTACAGAGAA
GTGGATAGAAAAGGTCCTTTGTTAGGGTCCTTTattaaACCTAATAGA