>JMCP008A03 412 bp,:Filtered
TCATGCAGACTTACATCGGGGGAGTTTCGTGCCCATACATATGCTCCAAGAGGCTGGACC
ATGGTGTCCTGTTGGTGGGTTATGGTTCAGCAGGCTACGCTCCCATCCGGTTGAAAGAAA
AACCATATTGGATCATCAAGAACTCGTGGGGCGAGAGCTGGGGAGAGAAGGGATACTACA
AGATCTGCCGGGGTCGCAATATCTGTGGAGTGGACTCCATGGTTTCTACTGTTGCAGCTG
TTAACACCCCCACTTCAGACTAGCAGGACAGGACACGTTCTGTAAAGTAGTTCTGTAAGA
TATTGTTTGTTTGCAAGCGTCTCACAGAGAGCCACACAAAACAACATACTATGCAAGTGT
ATTCATTATTAGATTTCATCAATCTATTTCTCAATTTC