>JMCP007H09 605 bp,:Filtered
TTCAACACTGACAACAACAACAACTACTACTACACCAACAACCGAGAAGAAACCTTCCCC
ACCACCACCACCGGCGGCGGCGGCGGCAACCGCTACAACTACAACAACGGCGGCGctgCA
AACAGGTTTGAGCAGCAAGGGATGAGCGACACAAGATTCATGGAAAATGGGAGGTATTAC
TATGATGTCAACACAGAGAAGTACGCCAgaCATCCATACGAGAATTCAAGAAACCAGTTC
AACAACAATGGAGGATTCGACAACAACAACAACAACAACAATGGATTCATGGAGAACAAC
TACCAGAATATGGAGGagTTCCAGGACCAAGAAgaccttcCCTGAGATTCCTTAACAATT
TTTTTTTTTTCTACAAAGTTAAAagaTGATCATGTGACggagtCCCAAAATCTGCAAATT
AAACACAcgACTGGGTGTTTGATTGTGTGTTAAATTATGGTTGTTTAGGGGTGAATATGT
TGATGATGATTAAgcTATagaTTTGTTCATAGGTTATTAATTATCTCCTGTCTCTATAGT
TATATTgtgTGTGAAtgagaccATGAAACTATGGTTTTGTG