>JMCP007G02 659 bp,
CTTGAAGCAGGCCTTGCTCAGCGTCTTCACCATTCACAATGAGACCCTCAATGTTTGGAC
GCATTTGGTGGGGTTCTTTCTCTTCCTTTCATTGACTATATATACTGCAATGAAGATTCC
AGATGTTGTAGACTTTCCAACTTTACAAAATCTTCCTGATGTGCTTAGAAAAGCTGATCT
GCACGCTTGTCTACCATCCCTGCTGCACATTCCTGATCTGCACAGGCTTCGGGAAGAACT
GAAGACTGCATTTCCATCACTTTCTAATTGGCATATTGTACAACTTCTCACTAACTGCCT
ACCCGAGTGTTTTTCTAACAGCAACCATACCAATGTTTGTGTTCTGAGTAGCATGAAGGA
AGATCTGGTGAACATAATAGCGCCATTGACGACCAGACCAATCACACGGTGGCCATTCTT
TGCATTCTTGGGCGGGGCAATGTTTTGCTTGCTAGCGAGCAGCACATGCCACTTACTATC
CTGCCATTCAGAACGCCTATCGTACATAATGCTAAGGCTCGACTATGCTGGCATTGCTGC
TCTGATATCAACTTCGTTTTACCCTCCTGTCTACTATTCCTTCATGTGCTACCCCTTCTT
CTGCAACCTCTATCTGGGATTCATCA