>rJMCP007F07 500 bp,
TTCAACACTGACAACAACAACAACTACTACTACACCAACAACCGAGAAGAAACCTTCCCC
ACCACCACCACCGGCGGCGGCGGCGGCAACCGCTACAACTACAACAACGGCGGCGCTGCA
AACAGGTTTGAGCAGCAAGGGATGAGCGACACAAGATTCATGGAAAATGGGAGGTATTAC
TATGATGTCAACACAGAGAAGTACGCCAGACATCCATACGAGAATTCAAGAAACCAGTTC
AACAACAATGGAGGATTCGACAACAACAACAACAACAACAATGGATTCATGGAGAACAAC
TACCAGAATATGGAGGAGCTCCAGGACCAAGAAGACCTTCCCTGAGATTCCTTAACAATT
TTTCTTTTTTCTACAAAGTTAAAAGATGATCATGTGACGGAGTCCCAAAATCTGCAAATT
AAACACACGACTGGGTGTTTGATTGTGTGTTAAATTATGGTTGTTTAG