>rJMCP007E08 548 bp,:Filtered
TTCAACACTGACAACAACAACAACTACTACTACACCAACAACCGAGAAGAAACCTTCCCC
ACCACCACCACCGGCGGCGGCGGCGGCAACCGCTACAACTACAACAACGGCGGCGCTGCA
AACAGGTTTGAGCAGCAAGGGATGAGCGACACAAGATTCATGGAAAATGGGAGGTATTAC
TATGATGTCAACACAGAGAAGTACGCCAGACATCCATACGAGAATTCAAGAAACCAGTTC
AACAACAATGGAGGATTCGACAACAACAACAACAACAACAATGGATTCATGGAGAACAAC
TACCAGAATATGGAGGAGTTCCAGGACCAAGAAGACCTTCCCTGAGATTCCTTAACAATT
TTTTTTTTTCTACAAAGTTAAAagaTGATCATGTGACGGaGTCCCAAAATCTGCAAATTA
AACACACGACCGGGTGTTTGATTGTGTGTTAAATTATGGTTGTTTAGGGGTGAATATGTT
GATGATGATTAAGCTATagaTTTGTTCATAGGTTATT