>JMCP007D08 376 bp,:Filtered
GTGGACGGCAAGAAGGGCAAGCGAAAGCGAAGCCGCAGCCGAAGCCGAAGTTCGAGGAAA
AGGTCACGGGATGATTACGACGAAgaTTCGTATTCATCGTCGTCGGAGTCTGATGACTCG
TATTCGGACAAAGATTCTTATGCTTCTGAGTCGACGGAGGGGGAGGAGGAGAGGAGGCGA
CGGCGGAAAGAGAGAAAGAGGAAAGATGGGGGAGATAAGGAGAAGGAACGCAAGCGAAGG
AGAGAGAAGGAAAAGGAGAGGAGGAGGAGAAAGGAGAAAGAAAGAGAGGAGAGGAAGAAG
AAGGAGAAGAGAAAGAAGAAAAAGAAGGAC