>JMCP007C06 459 bp,:Filtered
TCATAACAGCCGTTCTTGCTGGTATTATTTTGGCCGAGAATATCTACGCTGGAAGTTTGA
TTGGGGCATTCATCATAGTGATTGGTCTGTACTCAGTGGTGTGGGGTAAAAGCAAGGATG
AGACAAATGAGAAAGGGAAAATGCAAGAATTACCAATTGTGATGATGGACAGAGAGAGTG
TTGAATCCAAGGACACAATCAAATCTAAGCTCCAGGAGAAGACTCCACAAGAGGCTTAAA
ATATAGAATTTACTATTAAAAAGAAATTGTGTGCATGCAATTTGTACTCGTGATGGTATC
CTAAAGTTTTGAGGTCTTTATGTTATGTATTAATGTAATCGCTGGCTATATGCTGCTTTA
AACTTTCAAAGCAATGCATTTATAAAGTTGGTCGTAAAAGTGCTTCAATTCAACTTTAAT
TTATTCAC