>rJMCP007B11 406 bp,:Filtered
TTGGAGATGGTAAAActgAAATTcatATATTGATTATgacgagtctaAAATGGagctgTT
ATTGTGGGGGTctgATTctccaaCcaagTTTTctgTGTACTctgCcatTCCcatGctgct
TTTCctcccagcatATATGctgTTGTGctgTATTACTAATATGATGATTTATTAGGGTAT
AGTAGAGGGCGGTGCATAGCTGTCTGGGTACTTGCCCCtaACCTTACGAACTGGAAATAC
GcaggATTTGTGCTTGGATTTGTCTTTCTTTAAATAAAGCTTGTGTAATATCTACCACAT
ATGCTTTGAAAGAAAGCTGTTTAATATATATGTGGTGTCTGTGTGAATGTTGTATACTGA
AGGTGAATTATGGGTTGTcacatTATT