>JMCP007A05 646 bp,
tgTCCGGCCGGCCTTCTTtatCATCTTCATCTTCATCTTCAAcTCTTCAtTATTATGGAG
AAgagCAAATCTTTCCCttaCCACTCATCATCAGCCTACACGGAGGCCCGGTTCGACTTc
GAGGGCCGCACCAAATCCTACAGCTTCAATAGCCctgCAGGAgaCTGCAACCCGGAGgTG
AAGAGGaGGAagaGGGTGGCGGGTTATAACATGTACGCCatgGAGGGTAAGTTCAAATCA
TCCttgAGGAACAGCTTCAAGTGGATCAAGACCAAATTcACCCACACCTACTACGATTCC
TCCCAAACTTAACTCAATAATCTTCTATCCACACATACATATATACTACACCTACATATA
GGATCACtTTCCGCCCTAACTCTGCTTACTTCGAATTCCGATCCAATCCGATCCCATCCC
GTCCTCTTATCTAGCTTCTTGTCGTACGTACGTGCAGTGACTGCACTCTTCATCCAATTA
TATTGCAGGCCGGGGTTTCTTTTTCTTTTCCCAAGCTTAATTTATCTTTATGGTATCGAT
CTCATCCATCTATATATATATAGATGTATGATAATGTATCAGCTTTAATTATATTTTTGC
AATATATATTATATTTGTGATATGTAA