>JMCP006G05 641 bp,
CCGGGTGAGAAAAACAAGACAGAAACATAACAGTAGTGATAATGGCAGCAGAGGAGGGGT
TGAAGGTGGTGGGATTTTGGGTGAGTCCATTTGTACTGAGAGTGAAATGGGCACTTAGAA
TGAAAGGCCTTGAGTATGAATATATAGAAGAAGACATCTTCAACAAGACTCCTTTGCTTT
CCCAGCTGAACCCAGTTCATGCAAAGGTCCCTGTCTTAGTTCATAATGGGAAGCCATTGC
CTGAGTCGCTGCTCATCCTCGAGTACATCGATGAGACATGGAAGCATAACCCTTTGTTGC
CTGCAGATCCATATGAACGTGCCAGGGCTCGGTTCTGGGCTGGATTTGCCGAGTTTAAGA
TTCTGGACCCAGCATGGGAAGCACTGTGTTCCAAAGGGAAACAGCAAGAAAGTGCAGTGA
ACTCAGCCATGGAAGCCATGGAGAAGCTGGAAGCTGAGCTTAATGGGAAGCAGTTCTTTG
GAGGGGAGAAGATTGGGTATTTGGACCTTGTGGTAGGATGGGTTGCCCACAATCTCCCCA
TTTTTGAGGAAGTTGCATCACTGAAAATCTTTGATTCtcagaaATTTCCTGCcatTGCTG
aaTGgaagaacAGGTTTCTG