>JMCP006G04 569 bp,:Filtered
GCCGATGGCAAAGTTGTAGGTGGCGGAGTTGCCGGGACGCTGAAGGCGGCGTCACAAGTA
CAGCTGATTGTGGGCAGCTTCATAGCTGACGGGAAAAAGCCCAAGTATAAGCCGTCCTCC
ACACCACTGCCCCAAGCCCAATCAAATATGCTAAATTTCAGCGCTCAAGCTGCAGAAGCC
GCCAGCCCTTCCGAGGATGCCTCGAGCGCCTCTTCTGACGACAATGGCGGTGGGACTCCT
CTTAACCGTGGGCCTCCAACGTACGGTAACGCTAACCAGCCAGTTCCGACGATGCAGATG
TATGCAAACATGGGCTGGCCAAATTCCACCGTCAAGATGCATCATCCTTAATTCCTTCTT
GCTCGACTAGTTAGATGATCTTGGCGGGGAAAAAAAAAAAGGCTAACAGgtgTATGTTCA
TTCAACTTCTAATCTATATAttgCCTTCCCCATCGTTACTCttaCTCTTTTGTTTTCCct
agattCACcGagaGCCcgagaatGGTTTTCTTTGCGGcgacatATTGATATCTGTGTTTG
CATG