>JMCP006G02 541 bp,:Filtered
GTGTAATTTTAATTGGTTCACTTCCAACAAAAAGAACGTGACAACGTATAATAACTAGCC
AGGTAAAGAGAATCCAAGACATCTGTTTAGGAAAAAGAACTCACACTTGTTTCACTAGCA
TTCAAAATAATCATACTGCACAAACATATCATATAGTTATCAGCACCTAAAGCAAATTTA
TTGGTGAGGGATGTGCACAATTGCTTGCATTAAAATCCTTTTCAGCTGATCAATGCATAA
AATAAATGCTATAACTAGTCCGACTAGGATTATGATAAAGAAAAAATCTGACTAATATGA
AAGAAAAAAATATATTGTTAGCCAGCCAAAACAGGAGTGTAATATTGGCCATCTCACTTC
CAACAAAAGATTGTGATACCCTATAAGAAGGCAGGTAAAGAGAATCCAAGACATCTGTTA
CGGGAAAAACTCATACTGGTTTCACTAGCATTCAAAATAATCATTTGCACAAACAAATCA
TATAATTATCACCACC