>JMCP006F12 638 bp,
TATAGGTCGCGCGCTTAAGCGCCATCCATTTTCGGGGCTAGTTGATTCGGCAGGTGAGTT
GTTACACACTCCTTAGCGGATTTCGACTTCCATGACCACCGTCCTGCTGTCTTAATCGAC
CAACACCCTTTGTGGGACCTAGCTTAGCTGCACAGAGAGAGAGAGAGAGGGAGGGAGAGA
GGATCTCagGAAGACGGCTCcgtCGTTGCGAAAATGGTGACCTACAGATTCCATCAGTAC
CAGGTTGTcggAAGAGCGCTCCCGTcggAGACCGATGAGCACCCCAAGATCTACCGCATG
AAGCTCTGGGCAACCAATGAGGTCCGTGCCAAGTCCAAGTTCTGGTATTTTTTGAGGAAG
cTGAagaAAGTTAAGAAAAGCAATGGCCAGGTCCTCGCTATCAATGAGATATTTGAGAAG
TGCCCTACCAAGGTTAagaATTACGGGATATGGTTGAGGTACCAGAGCAGAACCGGGTAT
CACAATATGTACAAGGAGTTCCGTGACACAACCTTGAATGGCGCTGTTGAACAGATGTAC
ACTGAGATGGCTTCTCGTCACAGGGTGCGCCACCACTGCATCCAAATCATCAAGACAGCC
ACCATCCC