>rJMCP006F11 653 bp,
GTGAAAGCTAAGGTGGAGATCGAGTATTACTAGCTAGAATCGCCGCTTTCACGCTAGTTT
TGTGAGTACACTCCTACACTATACTACAAGGCCAAGATCACACTTTTCCGTTTATTGTAA
TAGGCCAATAGTCCACGTTGCAAGAGATCTCCAAACCAGGAATACACTTGTCTATACATT
CATGCAAGATACGGGTATATTCTGCCTATACATATACATATACATATCAACTGATATACG
CAATGGAATTTGTATTGTTATATACTAAAAACATATACTTTCATGACAGTTCTTCACATG
GCCTGCATTTACTGAACGAAAAAGAAGGAAAAAAGGCAAACAAATTGTCTTTGGACAAAA
TATACTAACTAACACTCTTTTCTAGCCTTTGAACACATTTCATTATGTTTTTCCATTTTC
CAAATCGAACAAGTGTTAGTTTTTACAATAATACCCCTAAAACCCAATAATTAGTGCATA
CCCGGCGAGGCTAGCTCAAGTGGTAAACCATCTAGCATAAAGTCACCTCTTTAGTAACAA
GGTAGGGTTTAACTTCCACCGCCAACGACATCTTGGAACTAAGGCTTCCCAACCTAGATT
TTGGGCCA