>JMCP006F07 257 bp,:Filtered
GTTTCAGGATCGTGAGGAATAGAGTGGCGCAGACGGCGGCGATGACGATGGCGATCAAAA
GCAGAGCGGTAGTGAAGCAACAGATTTTTCGACTTTTTGGAGCTGTAATTTCCATGGTGT
TTTGAGAATTTTTATCAATGATAATCAATTTTAATGATGAAACTTGTATTTATGTTTTTA
TATATAAATAGATATACACCTCTTCATCTTATC