>JMCP006F03 337 bp,:Filtered
CTCCGGGGACGTGTAAAAACGCGACGGAGTATGTTTTCTGGGATGGGTTTCATCCCACAG
AGGCAGCCAACCAAGTTTTGTCTGATGACTTACTTGCCGCCGGCCTTTCCCTCATCGGCT
AACTAACTTATTAATTGCATATATATACACTAAGTTTAACTTCAAGACAAATTAAGGGAT
TTCTCTTGTCTTGAATTTGTGATTTGTGATTTATTGTTGTCATATTGGTATTGTAATCAA
ATAACAGAGAGATCAGAGTGAGTGTATTCAACCCATGTTTATGCAATTTCATATTTTTTT
TGTAAGCAATAG