>JMCP006E03 657 bp,
CGCGGAGTGATTCTTAGTTCAAGGTTTCCCAAATAGTTTGGATCCGACGTTTCGCCTTGT
TTTTCTGGAACTCCACTCTGATCTGCAGAAGCACAAGCTGGTAGATCAAGAACTCCCTTT
TTtcttcaaggtttgaagggtcagatcTGGACTTTGCTTTTGAGGGATTTTAGGAGCACA
AAAAAGAGAATGTCTTTCATTGGGACTCAGCAGAAATGCAAGGCTTGTGAGAAGACAGTT
TATCCTGTGGAGCTGTTGTCAGCTGATGGGATTAATTATCACaagtctgtctTGCTTCAG
ATGCAGCCATTGCAAAGGCACCCTTAAGCTGAGTAATTACTCCTCAATGGAAGGTGTTCT
GTACTGTAAGCCCCATTTCGAGCAGCTCTTCAAGGAATCAGGGAATTTCAATAAGAATTT
TCAGTCACCTGCAAAGTCGGCTGACAAGTTAACCCCAGAGCTGACAAGGTCCCCTAGCAA
AGCTGCCAGCATGTTCTCCGGGACACAGGAAAAATGTGCTACTTGTGGGAAGACAGCTTA
CCCTCTGGAGAAGGTGACAGTGGAGAACCAATCCTACCACAAGTCGTGTTTTAAatgttc
tCATggTggatgcTCTTTAACTCCCTCG