>rJMCP006D12 654 bp,
GTAACATCAAATGCTGGATTCCAAACAGAAATACCCGAAGCAGCGATTTGTTCACCCAGT
CCTCCATGCGTATGCAACAGTTCTTTCGGAGATCTTTCTTCTATCACAATTTGTTGTCCA
GAAGACAAGGAGAGATCAACAGAAGTTAGGGGAGCGGCCACATAAAACGGTACACCATGA
TGCATAGCACAAACAGCAAGGCTGTAAGTCCCGATCTTGTTGGCAGTATCACCATTTGCA
GCTATGCGATCAGCTCCAACAATGACAGCATTCACACGTCCAGCTTTCATCAACGCGGCT
GCAGCAGAATCTGCTATGAGGGTGGCAGGAATGTTCTCGGTAACCAACTCAAATGCTGTC
AGTCTGGATCCCTGGTTGAAAGGGCGTGTTTCAGTGCAATAAGCCCTTTCCAAAAACCCT
GCAGTATTGACAGCCCGAATCACACCAAGAGCAGTTCCATACCCAGCCGTTGCCAGGCTG
CCAGTGTTGCAATGGGTTAATATCGATATCTTCTTGGAGCCCACCAGCTGATTTTGGAGA
AGAGAAGCTCCGTGCGACCCAATTGCTTTATTGGAAGCAACATCATCCTCGAGCATAATT
TCAGCTGCC