>JMCP006D09 189 bp,:Filtered
GGCCTGGCAGAAGATTCCTTCATAAATGCATCAATCTTTTTGTTTTGGACTGGTGATTCT
TCTGAAGTTCCAGAATCAAATGCAAATGTCGTATTTTTATTGTAGCAAAAAGTTACTGTT
TGTTTAAAGACTGGAATCTTGAATATGTATCTTTCTGTTTTCTTCAAAC