>rJMCP006B08 655 bp,
ACCGCTTTCCTTATAATATTCTCATCTCTCTCTCCTCGTTCGAGTGATTCTGTTTCTGTG
TAAGCTGCACAGTCGCAACGCATTGAGAGCTATAAACTCTTGGAAACAGGAAGATGAAAA
AGCTCTACAGTGCTTCTAAAGATGATAAATTCTTAGAATTTTGGAAGAGAGAGATTGGTT
TCTCGGCTGCCAGAACTTTCTCTCGCCGAATCTCTGCTTCCGAGGCTGTGGTGAAGCAAC
TTGATTTGTATGGGAAATTAAATGGTCATCAGGGATGTGTTAACACAATCAACTTCAACT
CCACCGGTGATATTCTGGTGTCTGGCTCTGATGACAAACAAGTAATTTTGTGGGACTGGG
CCACAAAGACATCAAAATTGTCATATCCATCAGGTCACTTGGATAACATCTTCCAGGCCA
AGTTCATGCCATTCACTGATGATCGTAAAATAGTCACTGCATCTGCTGATGGCCAGGTCA
GGCTTGGCCAAGTGCTGGAGAATGGTGAGGTAGACACAAAAAGGCTGGGAAAGCATCAAG
GTCGAGTACACAGTCTTGCTGTGGAACCAGGGAGCCCCTACATATTTTACAGCTGCGGTG
AAGaTGGTTTTGTTAAAC