>JMCP006B06 577 bp,:Filtered
GAGGTACGTGGGAGCTGCGGAGGTGGCAATGCATATGTCTGACAACTTAGCATTCTTTTC
GGGGGAATCATTAACATGAGTCAAAGTTTGGCTCAACCGGGTGTCTCCCAGGTTGTTCTT
GAGGACTTGGTGTAGGTATTTGCCGTCGTACTTGGGGCCTGCCAACATGTTTTGCCACGC
CGATGTGTTTCCTGGAAAGATATATGGTCCGTGCTCCTTGTAGAAAGGGACGATATCCTT
GCCGGCGTAGAGGGGGCGCTTGTTCTTGTCCGGCGCCGCTAACATGGTGGTCATCAGTCC
TCCGGTGCTCGTTCCggcaatCACATCGAaGTAGTCCGCTATTCTTGCAtccggacCGTC
aaAAGTTTGAAGCTGCTCTTcaaggtAAGCGACAATGGTGCCGGGGATGATGCCACGGAT
GCCACCTCCATCAATGCTAAGGATGGTGACAACGCCGCTGGGAGGGATGGACGCAGCAAT
GTACCCTCCGGTGGCGGGGGAcgaTGGGGTTGTCTGGCTGTTTCCCATTTcaaAGGATTG
GTATGATATAC