>JMCP006A03 244 bp,:Filtered
TCAACGCAGAGTGACCTTTACGGCTTCATCATCCCTTGAGACAAACATATTTGGGTCAAT
TACATGGACTAGCGGAAAATATAAAGTTAGAAGTCCAATCGTTGTAAATGTTGAGTAAGG
GAGTCAATCAGTTAAAGCGACAAATTGTTAGACATGTGACTAACTTGAGGCAGACCAGTA
TGAAAATCAAACATGTTTTGATGTTGAATAAAGTTTTTTTTTATGGTTGCATTTAAAAAA
AAAG