>rJMCP005H10 147 bp,:Filtered
AGCTGGGGCTGGGGTGGGCGTTGATATTGGTGTCGGGACTGGCGGCGGAGGAGGCGGCTA
GGGCTTACGATAATGCCGCGCGGGAGTTCCGCGGCGCCAAGGC