>JMCP005H06 397 bp,:Filtered
GGGAAAGCGTcGaGATCCTGATCGAAGAAgtGATGGAGAGAGGCACCAATAGCACGGAGA
GACTGAAGGTAGGCGAGGTGAGCCTCGGCGAGAGAGTCGCGCTGACGGATAGCTTCGTCA
AGGAAGGCGCAGCGGTCCCGACAGAGCGCCACCGCCGGCAGGTCATCGATCTTGGAGGTG
GTACACCCCATATTATTTATTTATTTTAAAAAGAAAAAAAGGAAAAGGAATTATATTATG
ATATGATGATAACATAATATGGTATAGTGGAGGAGCAATCACAGAAGAAGAGAGTGATTA
AGAAAAAGGCATGGCGACTGGGTGCGAGTGGAAGGAATTGAAATTTAGGGCA